a scientist has discovered a human gene from cancer cells. the nucleotide sequence of the template strand of the gene was determined as written below: 3’gacacgtacgagcctggacaccttaagagcgggctcggaacactggccccgattgacac5′ (a) study the nucleotide sequence of the template strand and write sense strand (showing direction) of the gene. (b) write down the mrna produces from this gene. (c) how many amino acids will be present in the protein product of this gene. (d) write amino acid sequence of the polypeptide
Essay Writing Service Features
Our Experience
No matter how complex your assignment is, we can find the right professional for your specific task. Achiever Papers is an essay writing company that hires only the smartest minds to help you with your projects. Our expertise allows us to provide students with high-quality academic writing, editing & proofreading services.Free Features
Free revision policy
$10Free bibliography & reference
$8Free title page
$8Free formatting
$8How Our Dissertation Writing Service Works
First, you will need to complete an order form. It's not difficult but, if anything is unclear, you may always chat with us so that we can guide you through it. On the order form, you will need to include some basic information concerning your order: subject, topic, number of pages, etc. We also encourage our clients to upload any relevant information or sources that will help.
Complete the order form
Once we have all the information and instructions that we need, we select the most suitable writer for your assignment. While everything seems to be clear, the writer, who has complete knowledge of the subject, may need clarification from you. It is at that point that you would receive a call or email from us.
Writer’s assignment
As soon as the writer has finished, it will be delivered both to the website and to your email address so that you will not miss it. If your deadline is close at hand, we will place a call to you to make sure that you receive the paper on time.
Completing the order and download